COSMID, a tool to find #CRISPR off-targets including indels (usually not found w/other tools).

From Georgia Tech comes a new web tool, COSMID, for finding CRISPR off-targets (OTs).  But, this one definitely adds something new to the already busy realm of OT-finding tools: the ability to find OTs with small insertions or deletions relative to the target, not just base-pair mismatches.   Like "mismatched" OTs, off-target cleavage can occur at "indel-OTs" as well; see Lin et al, Nucl. Acids Res. (17 June 2014) 42(11): 7473-7485.    

COSMID is described in a new publication by T.J. Cradick, et al.  COSMID: A Web-based Tool for Identifying and Validating CRISPR/Cas Off-target Sites, Molecular Therapy—Nucleic Acids (2014) 3, e214.    I've only used it briefly so far but it has a nice interface that allows the user to search for OTs with a user-specified max number of mismatches in combination with single-base insertions and/or deletions.  It also can perform PCR primer design for the OTs with the primers optimized for Surveyor-style mutation screening.    Thanks go to T.J. and colleagues for the nice addition to the CRISPR off-target screening toolkit.

Alas, this already raises a new caveat about my previous post reviewing off-targets in mice: I'm pretty sure that most or all of those citations did not look at indel OTs, only mismatch OTs.    !

Here's my review of published #CRISPR off-target mutation data from mouse embryo injections.

Here is a literature review of CRISPR off-target (OT) mutation analysis in mouse oocytes.    This review only concerns published experiments using “native” Cas9 that cuts both DNA strands, and not nickase-Cas9 experiments.  Although nickase-Cas9 is much less prone to OT mutation, editing is still generally less efficient than with native Cas9 .  Therefore it’s important to know whether the potential problem of off-target mutation rates with native Cas9 outweigh its utility.   All the data below is pertinent to mouse zygotes.  Other systems such as cell lines may have different OT rates.

Here’s a few pertinent questions to preface this review:  First, how should potential off-targets (OTs) be defined ahead of time?  It’s complicated by the fact that mismatches are less tolerated within the “seed” region of 8-12 bases proximal to the PAM site, and more tolerated in the more distal (5’) region of the protospacer.   So some groups define OTs as having perfect matches to the seed region, while other groups defined them as simply having fewer than a threshold maximum number of mismatches anywhere in the protospacer.   Alternatively, they can be scored for cleavage potential by algorithms such as the MIT CRISPR design tool.

Second, how is CRISPR performed? Some of these groups used RNA or DNA injections;  most used slightly varying injection concentrations.   

Third, how were the OTs screened?  Most of these did direct sequencing on PCR from founders or Surveyor-type assays.   Also, OTs often cut at lower efficiency than the on-target but the results depend on the assay sensitivity and the number of pups screened, which varies across studies.   So the data here is only a general comparison.

I’m not focusing on those differences here, since the overall picture is broadly similar - OT rates were generally low to nil.   

Let’s start with the pair of 2013 Cell papers from the Jaenisch lab.   

1.  Wang et al. (Cell 2013) was the first report of CRISPR-mediated mutagenesis in mouse zygotes.   They only considered OTs with perfect matches to the 12 bases adjacent to the PAM and also the PAM itself (NGG).  For 2 targets, they defined 7 total OTs. (A third gRNA they used had no OTs by this definition). In 7 mutants pups carrying mutations at 2 simultaneously-targeted gRNA targets, they found zero mutations at the 7 OTs.   

Bottom line:  7 OTs screened, 0 mutated.

2.  Yang et al (Cell 2013) screened OTs that were defined at having “up to 3 or 4” mismatches.  (In my experience most mouse CRISPR targets have several-to-many 3-base mismatches, and I’m guessing that most targets will have many 4-base mismatches in mammalian genomes.)  I believe they screened OTs for 5 targets across 4 different genes.   A total of 35 pups and ES cell clones were screened in separate experiments using different gRNAs.  Of 47 OTs, only 3 had mutations. Two of those sites were mutated in multiple mice, indicating fairly high rates at these particular OTs.   However, the mutated OTs all had only 2 or 1 mismatches, and the “high rate” OTs only had 1 mismatch near the 5’ end, distal to the seed region.   

Bottom line:  47 OTs screened, 3 mutated.

3. Li et al.  (Nat. Biotech. 2013).  Of 4 targets they used, only two had OTs with fewer than 4 mismatches or perfect seed matches, so they focused on those. 12 founders were screened. In a subset of pups also screened some more OTs that had perfect seed matches but were otherwise totally mismatched. 

Bottom line: more than 13 OTs screened, 0 mutated.

4.  Mashiko et al (Sci. Rep. 2013) were the first to publish on injecting plasmid DNAs into mouse zygotes for transient CRISPR expression.    Similar to Wang et al, they defined OTs as having a perfect match to the 12-13 bases adjacent to the PAM.  For two targets, they defined 7 and 4 OTs respectively; in 16 and 8 mutant pups made with either gRNA, they found one pup with a single OT mutation.

Bottom line:  11 OTs screened, 1 mutated.

5. Fujii et al (NAR 2013) targeted the Rosa26 locus, and reported that OT rates dropped as injected RNA concentrations were lowered.   They inspected 10 OTs with “3 or 4 mismatches” but each of these actually had a mismatch to the “N” of the PAM motif, which doesn’t affect targeting, so these were really “2” and “3” mismatched OTs.  No OT mutations were found for the true 3-mismatch OTs.  However they found mutations in all four 2-mismatch OTs,  particularly when injecting higher RNA concentrations .  They also examined 12 OTs for 2 targets in Hprt and found no OT mutations.

Bottom line:  22 OTs screened; 4 mutated but only in “2-mismatch” OTs.

6.   Wu et al (Cell Stem Cell 2013) targeted the Crygc gene and defined OTs as having no mismatches in a 14 base seed region of the target.  Of 10 OTs, 1 was mutated in 2 out of 12 pups.   

Bottom line:  10 OTs screened, 1 mutated.

7. Inui et al (Sci. Rep. 2014) examined about 10 OTs total for two targets, in Sox9 and Sf-1.

Bottom line:  ~10 OTs screened, 0 mutated.

8. Zhou et al (FEBS J. 2014) retargeted an EGFP cassette separately with two gRNAs.   OTs were defined using the MIT CRISPR design tool, and they analyzed a subset of these (15 OTs per target) by surveyor assay on the founder pups.  For one target, they detected mutations in 4 OTs, but not in any OTs for the second target.

Bottom line: 30 OTs screened, 4 mutated.

9. Mizuno et al (Mamm. Genome 2014) targeted the Tyr gene and screened 5 OTs in founders by sequencing.

Bottom line:  5 OTs screened, 0 mutated.

10.  Han et al (RNA Biol. 2014) used 4 targets and identified OTs with the MIT CRISPR design tool.  They screened 3 founders for the “top 5” potential OTs.

Bottom line:  20 OTs screened, 0 mutated.

  

Here’s a quasi-meta-analysis:

From these 10 studies, 5 (50%) were able to detect some degree of off-target mutation.

But from ~175 OT’s screened, mutations in only 13 (7%) were detected.  Several of these OTs had fewer than 3 mismatches to the target.

In conclusion, the consensus from many studies of CRISPR-mediated mouse engineering demonstrates that native Cas9 has a low rate of off-target effects in mouse zygotes.  Of course, targets should still be pre-screened when possible to avoid those that will have more potential off-targets, particularly those with fewer than 3 mismatches within the protospacer.   

Doug Mortlock 2014.

Bibliography

1. Wang, H., H. Yang, C.S. Shivalila, M.M. Dawlaty, A.W. Cheng, F. Zhang, and R. Jaenisch, One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering. Cell, 2013. 153(4): p. 910-8.

2. Yang, H., H. Wang, C.S. Shivalila, A.W. Cheng, L. Shi, and R. Jaenisch, One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell, 2013. 154(6): p. 1370-9.

3. Li, D., Z. Qiu, Y. Shao, Y. Chen, Y. Guan, M. Liu, Y. Li, N. Gao, L. Wang, X. Lu, and Y. Zhao, Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat Biotechnol, 2013. 31(8): p. 681-3.

4. Mashiko, D., Y. Fujihara, Y. Satouh, H. Miyata, A. Isotani, and M. Ikawa, Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci Rep, 2013. 3: p. 3355.

5. Fujii, W., K. Kawasaki, K. Sugiura, and K. Naito, Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Nucleic Acids Res, 2013. 41(20): p. e187.

6. Wu, Y., D. Liang, Y. Wang, M. Bai, W. Tang, S. Bao, Z. Yan, D. Li, and J. Li, Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell, 2013. 13(6): p. 659-62.

7. Inui, M., M. Miyado, M. Igarashi, M. Tamano, A. Kubo, S. Yamashita, H. Asahara, M. Fukami, and S. Takada, Rapid generation of mouse models with defined point mutations by the CRISPR/Cas9 system. Sci Rep, 2014. 4: p. 5396.

8. Zhou, J., J. Wang, B. Shen, L. Chen, Y. Su, J. Yang, W. Zhang, X. Tian, and X. Huang, Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting. FEBS J, 2014. 281(7): p. 1717-25.

9. Mizuno, S., T.T. Dinh, K. Kato, S. Mizuno-Iijima, Y. Tanimoto, Y. Daitoku, Y. Hoshino, M. Ikawa, S. Takahashi, F. Sugiyama, and K. Yagami, Simple generation of albino C57BL/6J mice with G291T mutation in the tyrosinase gene by the CRISPR/Cas9 system. Mamm Genome, 2014. 25(7-8): p. 327-34.

10. Han, J., J. Zhang, L. Chen, B. Shen, J. Zhou, B. Hu, Y. Du, P.H. Tate, X. Huang, and W. Zhang, Efficient in vivo deletion of a large imprinted lncRNA by CRISPR/Cas9. RNA Biol, 2014. 11(7): p. 829-35.

Optimal design of ssODNs (donor oligos) for #CRISPR - length and strandedness data?

(UPDATE Jan. 29 2016:  Also see my new post "For #CRISPR HDR, use donor oligos that are complementary to the "gRNA strand". A new paper shows why"- this supports the choice of strand to use, but also impacts the placement of the homology arms.)


For this CRISPR question I am going back to this paper:  Yang et al, Optimization of scarless human stem cellgenome editing, Nucleic Acids Research, 2013, 1–13  (from the Church lab).   Although this paper had a lot of TALEN data it had comparative data for CRISPR-mediated editing.  In this case, a 2-bp mismatch was engineered into the CCR5 locus in human iPS cells.    

First of all, from now on I will use the term "ssODN" to refer to single-stranded donor oligonucleotides.  (Hooray, more jargon!)   In Fig. 3d of Yang et al, they presented a nice series of data in which they varied both the length and the strandedness of the ssODN used for editing in conjunction with a single gRNA, which was held constant of course.   The mismatch was within the CRISPR target and was always positioned in the middle of the ssODN.  However, ssODN length varied from 50 to 110 nt.  (Strangely, the top panel has longer ssODNs also drawn schematically but no data for those was shown).  In addition, ssODNs corresponding to either the same strand or the complementary strand to the gRNA were tested.  

Now, if you're like me, you might naively assume that the complementary-stranded ssODN would be worse in mediating editing because it might base-pair with the gRNA itself, preventing the gRNA from functioning properly.    Sounds reasonable?  Turns out, the opposite was true - at least for this individual target.  Maximal efficiency of editing was achieved with the complementary ssODN at about 70 nt length, with an absolute efficiency of ~1.5% - not too shabby considering it's iPS cells and without any selection.  Interestingly, when non-complementary ssODN (i.e., same strand as the gRNA) were used, the efficiency never reached that efficiency, but it did increase with length up to the maximum tested length (110 nt) where it reached about 0.5%.  At this length, it was basically the same whether the complementary or non-complementary ssODN was used.

What should one take from this?  Well, the trouble with these sorts of tests is that when you test certain parameters you have to keep the other parameters fixed.  In this case the gRNA was kept constant.  So the peak in efficiency at 70 nt with the complementary ssODN might be a peculiarity of that particular sequence - perhaps it forms a secondary structure that just happens to inhibit the competing NHEJ pathway, for example?   

Also, there is a decent theme forming that for mouse oocyte injections, ssODNs should have homology arms of about 60 nt.  This puts the minimum length at 120 nt.


P.S. ...another thought added 12/15/14:    Note that for the above observation that max. editing efficiency was achieved with a complementary-strand ssODN of ~70 nt, this means the homology arms were each only ~35 nt long.  In fact, a 50 nt ssODN was as efficient as a 90 nt ssODN, meaning ~25 nt homology arms were also workable with a complementary ssODN.  But the non-complementary ssODN worked better with longer arms.  See Fig. 3 from the Yang paper.

New volume of Methods in Enzymology devoted to #CRISPR, TALENs, ZFNs.

The volume is entitled "The Use of CRISPR/Cas9, ZFNs, and TALENs in Generating Site-Specific Genome Alterations",  Methods in Enzymology, Volume 546, Pages 2-549 (2014).  Edited by Jennifer A. Doudna and Erik J. Sontheimer.    

A variety of great topics are addressed in this volume, including many that I've talked about in this blog, and it features chapters written by many of the authors of key papers that are also discussed in my blog posts.   Too many interesting chapters to list all the pubmed links here!

Paper: In vivo interrogation of gene function in the mammalian brain using #CRISPR-Cas9.

Swiech et al. used AAV vectors to mutate target genes in adult mouse brains.     This paper is notable for the careful measurement of on-target mutation efficiencies in vivo, including from single cell nuclei, which strongly indicated that about ~65% of transduced brain cells acquired mutations in both alleles of their initial target gene (Mecp2).  Off-target effects were apparently low (0-1.6 % rates of mutation at the "top predicted off-target" for each of 3 Dnmt family genes, measured in GFP+ cells).   With their AAV vectors, one vector supplies Cas9 production and the other expresses the guide RNA and also GFP; thus fluorescence indicates transduction.  They also introduce an AAV vector that coexpresses up to 3 guide RNAs + GFP for multiplexed targeting.

In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9

• Lukasz Swiech,
• Matthias Heidenreich,
• Abhishek Banerjee,
• Naomi Habib,
• Yinqing Li,
• John Trombetta,
• Mriganka Sur
• & Feng Zhang.

Nature Biotechnology.   19 October 2014

Poly Peak Parser can be useful for identifying new #CRISPR indels in F1s using PCR + Sanger chromatogram data.

Thank you to my colleague Max for pointing this out to me.  If you are doing CRISPR on mice, fish or whatever creatures you are working one, and you are direct-Sanger-sequencing PCR products from #CRISPR animals, you know that animals with more than one type of allele will generate confusing, overlapping sequence traces usual extending past the CRISPR cut site.  This is because CRISPR (or TALENS and ZFNs for that matter) usually generates indel mutations.   Although the sanger data is fine to confirm something got altered by CRISPR, the overlapping peaks make it hard to identify exactly what the indel is.     Poly Peak Parser is an easy to use web interface for pulling the alternate allele (e.g. the newly generated indel) out of an .abi or .scf file that has double peaks due to indel heterozygosity.  It is designed to be used on PCR Sanger data from F1 heterozygote animals.  

Poly peak parser: Method and software for identification of unknown indels using sanger sequencing of polymerase chain reaction products.Hill JT, Demarest BL, Bisgrove BW, Su YC, Smith M, Yost HJ.Dev Dyn. 2014 Aug 27. doi: 10.1002/dvdy.24183. [Epub ahead of print]         

Web tool:   http://spark.rstudio.com/yostlab/PolyPeakParser/

The catch is that you have to supply the reference allele sequence (such as wild type), and it really only works well if there are 2 and only 2 alleles embedded in the sanger data, one of which is the reference sequence.  Then it will extract the alternate allele from the double peak data.    I tried it out using sanger data from a mouse that was confirmed to be a heterozygote for wild type allele + a new, short deletion; Poly Peak Parser quickly returned the alternate allele confirming the 1 bp deletion.   

In practice, however, founder animals from CRISPR injections are usually not simply heterozygous for wild type and a new indel allele.  They usually have at least two mutated alleles and sometimes more, if they are mosaic.  As the authors of this tool state in their paper, Poly Peak Parser is really designed for analyzing F1 animals.   So here is a suggested workflow:

1.  If you have sanger files from PCRs of founder animals and they clearly have double peaks, try inputting the .scf along with a wild type reference sequence into Poly Peak Parser and see if it returns an alternate allele that looks like it mostly has unambiguous base calls.   

2. If the "alternate allele" has lots of ambiguous bases, the animal may be mosaic, or simply has two new but distinct mutations.

Either way, breed founder animals to wild type to get F1s and the data will be much more clear.

More protocols for mouse mutagenesis with #CRISPR: newly published in CPHG.

Harms et al have created this detailed set of protocols for conducting CRISPR/Cas9 mutagenesis and editing in mouse embryos.  Included are more guidelines and instructions for choosing targets, then on to ligation protocols for cloning protospacers in sgRNA expression vectors, in vitro RNA synthesis, pronuclear injection, and follow-up screening/genotyping of founder animals, as well as HDR donor design and considerations.  Also a timeline schematic.   


Mouse Genome Editing Using the CRISPR/Cas System.Harms DW, Quadros RM, Seruggia D, Ohtsuka M, Takahashi G, Montoliu L, Gurumurthy CB.Curr Protoc Hum Genet. 2014 Oct 1;83:15.7.1-15.7.27. doi: 10.1002/0471142905.hg1507s83.

A review about #CRISPR off-target effects with links to 10 online off-target identification tools.

Gene editing: how to stay on-target with CRISPR.  Vivien Marx.  Nat Methods. 2014 Sep 29;11(10):1021-6. doi: 10.1038/nmeth.3108.

In addition, let me reiterate some rules of thumb about minimizing off-target effects:

1.  3 or more mismatches in the 20-base protospacer are highly likely to prevent off-target cleavage.

2.  Or, consider using truncated protospacers of 17 or 18 bases.  The catch is you will probably have to pick a protospacer with a G as the first base to allow guide RNA transcriptional initiation.

3. I'm not sure if paired nickases are the best way to go yet.  A better way to think of it is that it may depend on the specific goal of your CRISPR experiment.      

Outstanding #CRISPR review: "A mouse geneticist's practical guide to CRISPR applications".

 Far above Cayuga's waters - my alma mater! - there are some excellent scientists using CRISPR to engineer mutations in mice.   This paper is from John Schimenti's lab at Cornell and I believe it contains the most thorough review of  mouse CRISPR engineering to date.   

A Mouse Geneticist's Practical Guide to CRISPR Applications.  Singh P, Schimenti JC, Bolcun-Filas E.  Genetics. 2014 Sep 29. pii: genetics.114.169771. [Epub ahead of print]

PMID:25271304

More than merely a review article, it has some additional new data from this group.  They tested whether inhibition of the NHEJ pathway could enhance efficiency of CRISPR-mediated homology-directed repair, since these pathways compete following CRISPR cleavage; this was based on similar experiments done in Drosophila using ZFNs to do HDR.   The answer seems to be yes, it helps in mouse embryos as well.  The compound they used was SCR7, an inhibitor of ligase IV (a key player in NHEJ).   Crucially, it seems that SCR7 can be applied directly to mouse embryo culture media with minimal toxicity.   Go to Table 2 for the result suggesting a shift in balance from predominantly NHEJ alleles toward more HDR alleles.     

Quoting from a new #CRISPR paper: "..requirements for Cas9 DNA binding are different from those for catalytic activity"

The paper is :  Protospacer Adjacent Motif (PAM)-Distal Sequences Engage CRISPR Cas9 DNA Target Cleavage. Cencic R, Miura H, Malina A, Robert F, Ethier S, Schmeing TM, Dostie J, Pelletier J.  PLoS One. 2014 Oct 2;9(10):e109213. doi: 10.1371/journal.pone.0109213. eCollection 2014.  

Two previous papers (Wu et al and Kuscu et al) showed that Cas9/guide RNA complexes are normally resident on many genomic sites, the vast majority of which do not get cleaved by Cas9.  Thus, binding does not automatically lead to cleavage - far from it.   The data in this paper clearly indicates the requirement of the PAM-proximal "seed" portion of the protospacer for initial Cas9/sgRNA binding, while the distal protospacer does not need to match to permit binding.  However, the additional pairing of the more distal portion of the protospacer is required for target cleavage.  Thus binding and cleavage are distinct steps.

One important implication of these studies is in regard to using cleavage-deficient Cas9, e.g. with both DNAse domains mutated, to physically localize fusion complexes (GFP, transactivation domains, etc) to genomic targets for reasons other than genomic editing.   Examples include fluorescent labeling of telomeres and upregulation of specific target genes. (Cheng et al and Perez-Pinera et al).

The results from this and the previous papers now clearly suggests that for CRISPR-Cas9 applications that only require binding to the target, not cleavage, off-target effects may be more widespread.   Whether that will be an serious problem, and maybe it won't be, will probably be very dependent on the application in question.  

In any event these papers provide data that may point the way to further increasing CRISPR/Cas9 specificity, in a variety of different applications and settings.

Methods for genotyping #CRISPR -generated mutations/edits: interesting alternatives.

Here are two papers with nice methods that are alternatives to the commonly used heteroduplex nuclease assays, e.g. Surveyor/Cel/T7E1.    First, a very new paper showing that simple PAGE gels can be pretty good for this.   Second, a paper from January that describes an in vitro method to use Cas9 itself + guide RNA to test PCR products for changes in "cuttability" following mutagenesis/editing.    

An Efficient Genotyping Method for Genome-modified Animals and Human Cells Generated with CRISPR/Cas9 System.

Zhu X, Xu Y, Yu S, Lu L, Ding M, Cheng J, Song G, Gao X, Yao L, Fan D, Meng S, Zhang X, Hu S, Tian Y.

Sci Rep. 2014 Sep 19;4:6420. doi: 10.1038/srep06420.

Genotyping with CRISPR-Cas-derived RNA-guided endonucleases.

Kim JM, Kim D, Kim S, Kim JS.

Nat Commun. 2014;5:3157. doi: 10.1038/ncomms4157.

The second paper gets around the problem of what if there are homozygous novel variants in some samples, as these are insensitive to simple heteroduplex assays unless you mix them with known wild type products first - which can be tedious and seems sort of wasteful to me personally.

Another gene-therapy-ish #CRISPR paper: germline correction of Duchenne muscular dystrophy mutation in mice.

 In this paper editing was performed in Mdx mutant mouse zygotes. Mdx is a classic mouse model for DMD.    Since Mdx is a point mutation that causes a premature stop codon in the dystrophin gene it was a natural target for CRISPR-mediated genomic editing.   

Science. 2014 Sep 5;345(6201):1184-8. doi: 10.1126/science.1254445. Epub 2014 Aug 14.Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA.Long C, McAnally JR, Shelton JM, Mireault AA, Bassel-Duby R, Olson EN.

Muscular dystrophies fall in the groups of disorders that may be particularly amenable to gene therapy, as restoring gene products to even a fraction of deficient myofibers within a muscle may provide some improvement in overall muscle function.

Somewhat wistfully, this reminded me of the first transgenic "rescue" of the Mdx mouse by Greg Cox et al. in Jeff Chamberlain's lab at Michigan, back in 1993…

Nature. 1993 Aug 19;364(6439):725-9.Overexpression of dystrophin in transgenic mdx mice eliminates dystrophic symptoms without toxicity.Cox GA, Cole NM, Matsumura K, Phelps SF, Hauschka SD, Campbell KP, Faulkner JA, Chamberlain JS.

#CRISPR paper: Disruption of PCSK9 in liver lowers cholesterol in mice.

PCSK9 is an attractive target as inhibitors reduce serum cholesterol and inactivating mutations are associated with reduced cholesterol as well; conversely gain-of-function mutations are associated with familial hypercholesterolemia.  Knockdown approaches in adult mouse liver had been done previously for PCSK9 but not yet with CRISPR.

Permanent Alteration of PCSK9 With In Vivo CRISPR-Cas9 Genome Editing

Qiurong Ding, 

Alanna Strong, 

Kevin M. Patel, 

Sze-Ling Ng,

Bridget S. Gosis, 

Stephanie N. Regan, 

Chad A. Cowan, 

Daniel J. Rader, 

Kiran Musunuru

.   Circ Res. 2014 Aug 15;115(5):488-92. doi: 10.1161/CIRCRESAHA.115.304351. Epub 2014 Jun 10.

Paper demonstrating #CRIPSR to correct human beta-thalassemia mutations in vitro.

  This made use of the piggyBAC transposon system to select for inserted clones; of the Puro+ clones, ~23% had undergone homologous recombination at HBB; of these, about 75% had recombined in such a way as to replace a mutation with wild type sequence.   

The piggyBAC transposon can be excised cleanly after the fact, allowing in vitro selection with a "clean getaway".   So this is very nice for certain in vitro applications. 
  
Seamless gene correction of β-thalassemia mutations in patient-specific iPSCs using CRISPR/Cas9 and piggyBac. Xie F, Ye L, Chang JC, Beyer AI, Wang J, Muench MO, Kan YW.  Genome Res. 2014 Sep;24(9):1526-33. doi: 10.1101/gr.173427.114. Epub 2014 Aug 5.

Paper: More details about what sequence features make a CRISPR target highly "cuttable".

This was interesting for several nice reasons.  First, my interpretation is that this suggests that while most CRISPR targets have some level of acceptable targeting by Cas9/sgRNA, there is a subset of sites that are *very* susceptible.  Therefore, if you want to make a null allele in a gene it's a good idea to score all the possible sites first with this sort of algorithm.

Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation.  Doench et al, Nat Biotechnol. 2014 Sep 3. doi: 10.1038/nbt.3026. [Epub ahead of print].

Second, they of course have made their scoring algorithm available as a web tool: http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design

I took a crack at it with a small DNA sequence from mouse that I know has a decent CRISPR target.  Interestingly, my pre-validated target had a lousy score (~0.05 on a scale from 0 to 1)  despite my knowledge that it works pretty well in my hands.  I take this to mean that of course, no scoring algorithm is perfect, but also that most targets actually fall into the so-so category of activity.   This jibes with data in this paper somewhat and I won't jump to conclusions based on my N=1!   I'd be interested to hear other people's results from running their targets through this algorithm.

Paper: #CRISPR optimization in mouse ESCs, with 50 vs 200 bp arm comparison for HDR. Longer arms better.

 This was just out in PLoS ONE: 
Optimization of Genome Engineering Approaches with the CRISPR/Cas9 System, by Li et al.   The final figure shows a direct comparison between 50 and 200 bp homology arms for GFP knock-in via CRISPR-mediated HDR;  no big surprise, but clearly 200 bp had greater efficiency to 50 bp, by about an order of magnitude.   This is useful info for anyone who is designing "large" knock-in cassettes and wondering if it's important to put long arms on the cassettes; although ~60 bases is commonly used for ssDNAs in HDR (i.e. for peptide tag or loxP insertion), it's important to lengthen them for longer cassettes.    I suggest ~1 kb.  (my gut feeling as of today).

Seamless correction of beta-thalassemia mutations in iPSCs using #CRISPR and piggyBac transposon.

Efficient genome editing in human cells for therapeutic purposes will continue to be one of the most anticipated uses of CRISPR.  Here's a new, good example of this direction, from Genome Research.   

Seamless gene correction of β-thalassemia mutations inpatient-specific iPSCs using CRISPR/Cas9 and piggyBac.

Fei Xie, Lin Ye, Judy C. Chang, et al.

Genome Res. published online August 5, 2014 

Correction to my post "Protocol for cloning protospacer adapters...PX330-family #CRISPR plasmids".

There was an error - now corrected - in my previous protocol post  "Protocol for cloning protospacer adapters into Zhang lab PX330-family #CRISPR plasmids.":  I omitted by mistake the instruction to add the ligase enzyme to the ligation reaction. (line II - 2 - e in the protocol).  Duh!    I apologize profusely.

Hard numbers re: eGFP and CRE knock-ins with #CRISPR in rat zygotes!

This one has important implications for CRISPR-mediated insertion of fragments in the several-kilobase size range, such and GFP, CRE, etc. , into rats - and likely, mice - via pronuclear injection.  

Generation of eGFP and Cre knockin rats by CRISPR/Cas9.   FEBS Journal.  Accepted manuscript online: 17 JUL 2014.   

Yuanwu Ma¹, 

Jing Ma¹, 

Xu Zhang¹, 

Wei Chen¹, 

Lei Yu¹, 

Yingdong Lu¹, 

Lin Bai¹,

Bin Shen², 

Xingxu Huang^2,* and

Lianfeng Zhang¹

A brief summary from a quick dig I made into this paper:  They did 3 different CRISPR targeted kncok-ins, that is, using HDR to insert cassettes into genes of interest.  The cassettes were GFP and CRE into 1 and 2 different genes respectively.  This was all done by pronuclear injection into rat zygotes, of RNAs for Cas9 and guide RNA plus circular, double-stranded DNA plasmids containing the cassettes of interest.    So this is technically, essentially the same process one would use for mice.   Their numbers were quite impressive:   between 23% to 54% of live pups carried the targeted insertion.

A key ratio to scrutinize is the ratio of targeted insertions to the total number of insertions and other mutations, e.g. indels.   The reason is that the total number reflects the number of pups in which CRISPR clearly had activity.   Therefore the ratio reflects the proportion of the time that the HDR process occurred successfully as a subset of all embryos that had some sort of CRISPR-mediated cleavage event.  Since almost all of their live pups had evidence of the HDR insertions or indels anyway, the ratio of targeted/all events is still about 25-50%.   

How big were the homology arms used?   Between ~1.5 to 2.1 kb in all cases (3 constructs x 2 arms each = 6 arms total).    Concentrations used were:   25 ng/µl Cas9 mRNA, 10 ng/µl, and 4 ng/µl of the donor plasmid in circular form.   

New paper: Mosaicism and complexity in #CRISPR founder mice.

Yen et al. recently published a paper in Developmental Biology (Yen at al, 2014) with some important observations about founder mice generated from injecting CRISPR tools into mouse zygotes.

They targeted Tyrosinase (Tyr), which causes albinism in the homozygous-null state and thus an easy readout of CRISPR function to mutate this gene.   Like others, they observed high rates of success with many fully albino mice being generated, indicating no surviving wild-type alleles.   However, they note many genetically mosaic animals were born too - these had patches of white fur among the pigmented fur, indicating clusters of homozygous-mutant cells, among other patches of cells that clearly still had wild type Tyr function.   This clearly suggests a high rate of CRISPR mutation that did not occur till after the first embryonic cell division.  They also did sequencing on the live born founders to determine the new mutations in the target gene.  This revealed that the mice could clearly contain more than two types of detectable new mutant alleles.  In fact, they found 57 mutant alleles in 23 total mice!    So, determining the exact mutagenic outcome in a founder animal is complex.   Furthermore, founder mice could potentially transmit more than two types of mutant alleles to their progeny, presuming their germline will also be mosaic.   Of course, F1 progeny must be carefully screened and sequence-validated to figure this out.

Current thoughts on targeting reporter cassettes in mice using #CRISPR.

 As an advocate of the PX330 plasmid for implementing CRISPR in mouse zygotes, I am trying to figure out optimal conditions for enabling homology-dependent repair (HDR) with this system.  Genome editing requires HDR, and a donor DNA molecule must be supplied along with the CRISPR/Cas tools such as PX330.  

For introducing "smallish" edits or insertions - like, under 70 bases or so - one can order a single-stranded super-long oligo such as IDT's ultramers.  Larger insertions are going to require double stranded DNA fragments.  Most molecular biologist are well used to purifying these, once they are designed.   Here's a few considerations:

1.  If the CRISPR target is also present in the homology arms of a double-stranded donor, it's probably gonna cut the donor before it gets a chance to donate anything.

2.  What should the optimal ratio of donor/CRISPR/Cas9 be?    I am assuming roughly a 1:1 mass ratio.   My only guidance so far is from the Yang et al 2013 Cell paper.  They were coinjecting donor DNAs with RNAs for guide RNA & Cas9.   Here I will focus on their data for fluorescent reporter fragment insertions, which were injected as circular dsDNA plasmids.   Although this group mainly does cytoplasmic injections, they tested pronuclear injections too.

For pronuclear injections of these reagents. Yang et al  reported 9% and 18% targeting rates, using two different donors and targets.    The concentrations were:  10 ng/µl donor plasmid, 2.5 ng/µl guide RNA, 5 ng/µl Cas9 mRNA.    Thus the total nucleic acid burden of the pronuclear injection material was ~17 ng/µl.   Those with actual experience with mouse embryo injections will note this is rather high;  most DNA transgenes are injected at 1-5 ng/µl, no more.  Why no more?   It can cause toxicity, but even more often and more frustrating, it leads to frequent needle clogging at the injection microscope.   Injected material at these concentrations will need very careful preparation beforehand.  I suggest that a 0.22 micron spin filter be used before each injection over a total 5 ng/µl limit.  Anyway, a ratio of ~1:1 or maybe ~3:2 mass ratio of donor DNA vs. CRISPR reagents seems reasonable.    For PX330 I am starting off by suggesting 4 ng/µl PX330 + 6 ng/µl donor plasmid - although I have no data yet showing whether this is optimal.

Low rate of #CRISPR off-target mutations in human iPS cells, reported in 2 new papers.

Veres A, Gosis BS, Ding Q, Collins R, Ragavendran A, Brand H, Erdin S, Talkowski ME, Musunuru K.   Low Incidence of Off-Target Mutations in IndividualCRISPR-Cas9 and TALEN Targeted Human Stem Cell Clones Detected by Whole-GenomeSequencing.  Cell Stem Cell. 2014 Jul 3;15(1):27-30.

Smith C, Gore A, Yan W, Abalde-Atristain L, Li Z, He C, Wang Y, Brodsky RA, Zhang K, Cheng L, Ye Z.   Whole-Genome Sequencing Analysis Reveals HighSpecificity of CRISPR/Cas9 and TALEN-Based Genome Editing in Human iPSCs.  Cell Stem Cell. 2014 Jul 3;15(1):12-3.

These papers are very important for using WGS to thoroughly catalog all variants in iPS cells post-CRISPR (and TALENs).  Good news:  Very very low rate of off-target (OT) CRISPR mutations, in contrast to some previous reports of high OT rates in transfected cells.   The authors suggest that the discrepancy may exist because the other studies used different, more commonly-used, "workhorse", non-stem, transformed/quick replicating cell lines.  It's possible that there are some technical differences in transfections and/or specific CRISPR reagents that contribute to these differences, but it is nice to see two different groups in agreement on the iPS situation.  Also, this is reminiscent of the observation by several groups that CRISPR OT effects in mice (generated by zygote injection of CRISPR reagents) are also very minimal.

So this is the not-so-good news, not for CRISPR per se, but for clonal propagation of iPS cells in general:  Both groups discovered that iPS clones accumulated numerous non-CRISPR-related new mutations.  That is, the act of isolating and passaging clonal cell lines itself led to accumulation of 50-100 new single-nucleotide variants not seen in the parental cell line.  This is genome-wide, so only a few of these are likely to be within exons, but still.     The bottom line is that iPS subclones are not, strictly speaking, genetically identical to the parent cell or each other.  Whether this is going to be a major problem going forward in the iPS field remains to be seen.

Protocol for cloning protospacer adapters into Zhang lab PX330-family #CRISPR plasmids.

This is also publicly accessible at the Vanderbilt labnodes website.

Cloning protospacer adapters into PX330/PX335/PX458/PX459 (Zhang lab, MIT) via BbsI site.

I.               Anneal top and bottom oligos of adapter

1.     Resuspend oligos in water to 1 µg/µl concentration.

2.     Combine the following in a 200 µl PCR tube:

a.     5 µl “top” oligo

b.     5 µl “bottom” oligo

c.     10 µl of 10x annealing buffer

d.     80 µl water

(10X Annealing Buffer: 1 M NaCl / 10 mM EDTA pH 8.0 / 100 mM Tris pH 7.5)

3.     Mix well.  Run the mix in a thermal cycler with an annealing program, such as:  Step (1) 94˚ for 3 minutes; Step (2) cool from 94 ˚ to 25˚ slowly, such as over a 30 minute period.  Alternatively to a thermal cyler:  Heat a beaker of water to boiling. Float the tube in the boiling water bath for 5’. Remove the beaker from the heat and let it cool off naturally on a benchtop, till it is room temperature.

4.     Transfer the annealed adapter to a 1.5 ml tube.  Add 900 µl water.  The final concentration of annealed adapter is now ~ 10 ng/µl.

II.              Ligate to BbsI-cut vector.

1.     Before you start:  You will need to have the vector DNA previously cut with BbsI and gel-purifed, and in 10 mM Tris or Lo-TE at a concentration of at least 10 ng/µl.

2.     I use the NEB Quick Ligation kit, and I reduce the volumes by half to save reagents.  It works great.  Combine the following in this order:

a.     2.5 µl of 10 ng/µl BbsI-cut vector

b.     1 µl of 10 ng/µl annealed adapter

c.     1.5 µl of water

d.     5 µl of 2x Quick Ligase buffer

e.   0.5 µl of Quick Ligase enzyme

3.     Mix briefly, and incubate at room temp. for 5’.  Use immediately for transformation.

III.            Transform DH5a cells.

1.     You will need a 42˚ water bath and LB+AMP plates.  You will also need to get a tube of competent DH5a cells from the 9^th floor core in Light Hall.  Thaw the cells on ice.

2.     Transfer 100 µl cells to a 1.5 ml tube.

3.     Add 5 µl of the ligation reaction. Mix well (do not vortex).

4.     Incubate 45’ on ice.

5.     Heat-shock the cells at 42˚ for 2’.

6.     Transfer cells back to ice.

7.     Add 900 µl of LB media to the cells. Transfer the cells to a 15 ml tube.

8.     Recover the cells by incubating in a 37˚ shaker incubator for 30’ at 250 rpm.

9.     Plate out 100 µl of the cells on an LB+AMP plate. Incubate at 37˚ overnight.  You should get at least a few dozen colonies (e.g. 10-100 is typical). Most of them will contain the correctly cloned product.   When I have done negative controls with no adapter, I get zero or just a couple of colonies.

IV.           Screen colonies for correct insertion of adapter.

1.     Inoculate 2 colonies separately into 15 ml tubes with 2 mls of LB+100 µg/ml AMP.  Shake overnight at 37˚.

2.     Perform Qiagen minipreps on 1.5 ml of each plasmid culture.  Save the remaining ~0.5 ml for making a glycerol stock to store at -80˚. (see below).  The culture sample can be stored at 4˚ for a few days before you make the glycerol stock.

3.     Spec the DNA.  Usually the concentration is about 40-100 ng/ul.    Prepare a sample for direct Sanger sequencing using this primer:

U6F1:              TACGATACAAGGCTGTTAGAGAG

This sequencing will read-through the region of the BbsI site and verify that the adapter has inserted properly.

V.             Make glycerol stocks of the correct clones.   To the remaining ~0.5 ml of the miniprep culture in step IV above, add 0.5 ml of sterile 30% glycerol.   (Glycerol solutions should be sterilized by filtration, never autoclaving.) Mix and store the glycerol stock at -80˚.

Doug Mortlock 7/2/14